WormMine: Gene WBGene00039237

• WormBase Gene ID: WBGene00039237
• Gene Name: CBG20196
• Sequence Name: CBG20196
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule-based process. Predicted to be located in microtubule. Is an ortholog of C. elegans tbb-2. In C. elegans, tbb-2 is involved in meiotic spindle organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20196b.1	CBG20196b.1		[unknown]
Transcript:CBG20196a.1	CBG20196a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20196b	CBG20196b		[unknown]
CDS:CBG20196a	CBG20196a		[unknown]

0 RNAi Result

5 Allele

• WBVar00049454
• WBVar00049449
• WBVar00049459
• WBVar00049444
• WBVar00128274

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053824
• Remark: Cbr-tbb-2, GAGGCTGAGAGCAACATGAACGATCTCATCTCCGAGTACCAGCAATACCAGGAGGCCACC, WBGene00039237
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region