WormMine: Gene WBGene00039259

• WormBase Gene ID: WBGene00039259
• Gene Name: Cbr-cam-1
• Sequence Name: CBG20223
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine kinase activity. Predicted to be involved in cell surface receptor protein tyrosine kinase signaling pathway. Is an ortholog of C. elegans cam-1. In C. elegans, cam-1 is involved in generation of neurons and neuroblast migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20223b.1	CBG20223b.1		[unknown]
Transcript:CBG20223a.1	CBG20223a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20223a	CBG20223a		[unknown]
CDS:CBG20223b	CBG20223b		[unknown]

0 RNAi Result

43 Allele

• WBVar00139160
• WBVar00139161
• WBVar00139162
• WBVar00139152
• WBVar00139153
• WBVar00139150
• WBVar00139151
• WBVar00139156
• WBVar00139157
• WBVar00139154
• WBVar00139155
• WBVar00139158
• WBVar00139159
• WBVar00050794
• WBVar00050799
• WBVar00050809
• WBVar00050804
• WBVar00050824
• WBVar00050829
• WBVar00050814
• WBVar00050819
• WBVar00050784
• WBVar00050789
• WBVar00050779
• WBVar00050774
• WBVar00128322
• WBVar00128321
• WBVar00128320
• WBVar00128326
• WBVar00128325

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1050301
• Remark: CBG25460, AAGACGACGATTTAGTCATCGAGCCAGCCGACGATGAGGGTCTTCACTATGGAAATGCGT, WBGene00086874
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1063437
• Remark: Cbr-cam-1, AACCATACGAAGGGGCAACGAATCAGCAAGTGATTGAGCTGATTGCGAATCGCCATCTGC, WBGene00039259
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region