WormMine: Gene WBGene00039434

• WormBase Gene ID: WBGene00039434
• Gene Name: Cbr-cdo-1
• Sequence Name: CBG20456
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable iron ion binding activity and oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen. Is an ortholog of C. elegans cdo-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20456.1	CBG20456.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20456	CBG20456		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068238
• Remark: Cbr-cdo-1, ACCAAATGCACGGTGACATTCTACTCGAAATACGGAGAAAAAATCGATTATCATGGATCG, WBGene00039434
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region