WormMine: Gene WBGene00039524

• WormBase Gene ID: WBGene00039524
• Gene Name: Cbr-mig-6
• Sequence Name: CBG20566
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to be involved in extracellular matrix organization. Is an ortholog of C. elegans mig-6. In C. elegans, mig-6 is involved in several processes, including anatomical structure morphogenesis; distal tip cell migration; and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20566b.1	CBG20566b.1		[unknown]
Transcript:CBG20566a.1	CBG20566a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20566a	CBG20566a		[unknown]
CDS:CBG20566b	CBG20566b		[unknown]

0 RNAi Result

19 Allele

• WBVar00128836
• WBVar00128835
• WBVar00128834
• WBVar00128833
• WBVar00128838
• WBVar00128837
• WBVar00128832
• WBVar00128831
• WBVar00128830
• WBVar00128825
• WBVar00128824
• WBVar00128823
• WBVar00128822
• WBVar00128829
• WBVar00128828
• WBVar00128827
• WBVar00128826
• WBVar00128821
• WBVar00128820

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054987
• Remark: Cbr-mig-6, AGGGAAATGCAAATAGATTCGATTCAGAATTGGACTGCTTCCGTCAATGCTCTAGCGTGA, WBGene00039524
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region