WormMine: Gene WBGene00039691

• WormBase Gene ID: WBGene00039691
• Gene Name: Cbr-nep-17
• Sequence Name: CBG20766
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metalloendopeptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans nep-17.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20766c.1	CBG20766c.1		[unknown]
Transcript:CBG20766b.1	CBG20766b.1		[unknown]
Transcript:CBG20766a.1	CBG20766a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20766a	CBG20766a		[unknown]
CDS:CBG20766b	CBG20766b		[unknown]
CDS:CBG20766c	CBG20766c		[unknown]

0 RNAi Result

17 Allele

• WBVar00139359
• WBVar00139361
• WBVar00139362
• WBVar00139360
• WBVar00139365
• WBVar00139363
• WBVar00139364
• WBVar00029722
• WBVar00029727
• WBVar00029732
• WBVar00029737
• WBVar00029707
• WBVar00029742
• WBVar00029712
• WBVar00029747
• WBVar00029717
• WBVar00029752

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052908
• Remark: CBG20766, CTGTCCATTGGGATCGAACAGTGCTCCAAAGCAGCACTGTGAAGTCTGGGTTCCAAAAAA, WBGene00039691
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region