WormMine: Gene WBGene00039779

• WormBase Gene ID: WBGene00039779
• Gene Name: Cbr-gcy-29
• Sequence Name: CBG20868
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-29.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20868.1	CBG20868.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20868	CBG20868		[unknown]

0 RNAi Result

15 Allele

• WBVar00029882
• WBVar00029852
• WBVar00029887
• WBVar00029857
• WBVar00029892
• WBVar00029862
• WBVar00029897
• WBVar00029867
• WBVar00029902
• WBVar00029872
• WBVar00029842
• WBVar00029907
• WBVar00029877
• WBVar00029847
• WBVar00029912

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052791
• Remark: Cbr-gcy-29, CAGAAATGGCAAGCACAATCGATTCTCCGTCGTCAACAATCTGATATCTACGCTTTTGGA, WBGene00039779
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region