WormMine: Gene WBGene00039805

• WormBase Gene ID: WBGene00039805
• Gene Name: Cbr-xrn-2
• Sequence Name: CBG20900
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 5'-3' RNA exonuclease activity and nucleic acid binding activity. Predicted to be involved in nucleobase-containing compound metabolic process. Predicted to be located in nucleus. Is an ortholog of C. elegans xrn-2. In C. elegans, xrn-2 is involved in several processes, including miRNA catabolic process; negative regulation of miRNA-mediated gene silencing; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20900.1	CBG20900.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20900	CBG20900		[unknown]

0 RNAi Result

1 Allele

• WBVar00129144

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055308
• Remark: Cbr-xrn-2, TGAAGGGTTATTTGACAAAAGACGGAATCCCAGAGTTGGATAGAGTTGAGATGATCATGA, WBGene00039805
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region