WormMine: Gene WBGene00039894

• WormBase Gene ID: WBGene00039894
• Gene Name: CBG21007
• Sequence Name: CBG21007
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans Y53F4B.12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21007a.1	CBG21007a.1		[unknown]
Transcript:CBG21007b.1	CBG21007b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21007b	CBG21007b		[unknown]
CDS:CBG21007a	CBG21007a		[unknown]

0 RNAi Result

26 Allele

• WBVar00030037
• WBVar00030042
• WBVar00057554
• WBVar00057559
• WBVar00057544
• WBVar00057549
• WBVar00057564
• WBVar00057569
• WBVar00057574
• WBVar00057539
• WBVar00057534
• WBVar00129261
• WBVar00129262
• WBVar00129263
• WBVar00129264
• WBVar00129260
• WBVar00129265
• WBVar00129266
• WBVar00026109
• WBVar00026114
• WBVar00026119
• WBVar00026124
• WBVar00026129
• WBVar00026134
• WBVar00026139
• WBVar00026144

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054503
• Remark: CBG21007, ACTACAACTCCCAAGAAGTTCATTTATTCGCCAATGAGGAACCTGAACTCCCCTTCTTTT, WBGene00039894
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region