WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039897 Gene Name  Cbr-cnt-1
Sequence Name  ? CBG21011 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable GTPase activator activity. Is an ortholog of C. elegans cnt-1. In C. elegans, cnt-1 is involved in apoptotic process; negative regulation of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate biosynthetic process; and positive regulation of endosome to plasma membrane protein transport. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG21011b.1 CBG21011b.1   [unknown]
Transcript:CBG21011a.1 CBG21011a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG21011b CBG21011b   [unknown]
CDS:CBG21011a CBG21011a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-cnt-1, ATTGCTGAAACGTGGCGCTGATAACAACCTGGCCAATGTTGACAGTAAAACTCCATTGGA, WBGene00039897   Expr1057290 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region