WormMine: Gene WBGene00040017

• WormBase Gene ID: WBGene00040017
• Gene Name: Cbr-prmt-5
• Sequence Name: CBG21172
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable methyltransferase activity. Is an ortholog of C. elegans prmt-5. In C. elegans, prmt-5 is involved in several processes, including intrinsic apoptotic signaling pathway in response to DNA damage; negative regulation of DNA damage response, signal transduction by p53 class mediator; and response to odorant.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21172b.1	CBG21172b.1		[unknown]
Transcript:CBG21172a.1	CBG21172a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21172a	CBG21172a		[unknown]
CDS:CBG21172b	CBG21172b		[unknown]

0 RNAi Result

6 Allele

• WBVar00129461
• WBVar00129463
• WBVar00129462
• WBVar00129465
• WBVar00129464
• WBVar00129466

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062582
• Remark: Cbr-prmt-5, GAAATCGCCCGAAAAATGAACTATCACCAGCCGGATCTCATCGTCTCCGAGTTGCTCGGA, WBGene00040017
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region