WormMine: Gene WBGene00040056

• WormBase Gene ID: WBGene00040056
• Gene Name: Cbr-nas-1
• Sequence Name: CBG21213
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metalloendopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans nas-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21213.1	CBG21213.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21213	CBG21213		[unknown]

0 RNAi Result

17 Allele

• WBVar00129567
• WBVar00129566
• WBVar00129569
• WBVar00129568
• WBVar00129571
• WBVar00129570
• WBVar00129573
• WBVar00129572
• WBVar00129574
• WBVar00129559
• WBVar00129558
• WBVar00129561
• WBVar00129560
• WBVar00129563
• WBVar00129562
• WBVar00129565
• WBVar00129564

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060519
• Remark: Cbr-nas-1, AATAATCATTTCACTTCAATTATGGGAAAAGCCAACGACTTCTCCACATCCGACCTTCGT, WBGene00040056
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region