Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG21320.1 | CBG21320.1 | [unknown] |
Other
9 Allele
Public Name |
---|
WBVar00016074 |
WBVar00016059 |
WBVar00016044 |
WBVar00016079 |
WBVar00016064 |
WBVar00016049 |
WBVar00016069 |
WBVar00016054 |
WBVar00045369 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L1_vs_embryo_downregulated |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-gars-1, AAAGACCACTCCATACACTGTGACGATTCGCCACGCGGAGACAATGTCGCAGATTCGGCT, WBGene00040130 | Expr1054367 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CBG21322, AATCTCCGTACATGCTTCGCCTCCGGATGCCTGTTTGTCGCCTACGAGGAAACCCGAAAA, WBGene00040131 | Expr1053640 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
7 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
enables | |
involved_in | |
involved_in | |
located_in |