WormMine: Gene WBGene00040153

• WormBase Gene ID: WBGene00040153
• Gene Name: CBG21349
• Sequence Name: CBG21349
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metallocarboxypeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans ZC434.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21349c.1	CBG21349c.1		[unknown]
Transcript:CBG21349b.1	CBG21349b.1		[unknown]
Transcript:CBG21349a.1	CBG21349a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21349b	CBG21349b		[unknown]
CDS:CBG21349a	CBG21349a		[unknown]
CDS:CBG21349c	CBG21349c		[unknown]

0 RNAi Result

1 Allele

• WBVar00129824

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061470
• Remark: CBG21349, AAGTCTGTCAGATTTCTGCCATCTACATGAGACAAGACTGTGCAAGAACTTGTAGATTCT, WBGene00040153
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region