WormMine: Gene WBGene00040164

• WormBase Gene ID: WBGene00040164
• Gene Name: Cbr-apd-3
• Sequence Name: CBG21360
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Predicted to be part of AP-3 adaptor complex. Is an ortholog of C. elegans apd-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21360.2	CBG21360.2		[unknown]
Transcript:CBG21360.1	CBG21360.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21360	CBG21360		[unknown]

0 RNAi Result

27 Allele

• WBVar00129855
• WBVar00129854
• WBVar00129856
• WBVar00014239
• WBVar00129831
• WBVar00129833
• WBVar00129832
• WBVar00129835
• WBVar00129834
• WBVar00129837
• WBVar00129836
• WBVar00129839
• WBVar00129838
• WBVar00129841
• WBVar00129840
• WBVar00129843
• WBVar00129842
• WBVar00129845
• WBVar00129844
• WBVar00129847
• WBVar00129846
• WBVar00129849
• WBVar00129848
• WBVar00129851
• WBVar00129850
• WBVar00129853
• WBVar00129852

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050227
• Remark: Cbr-apd-3, CAAAAGAGGCACCGAAGGCCGCGTCGTTGTTCGGACGAACTGTTGGCGGGCAGCCAATTT, WBGene00040164
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region