WormMine: Gene WBGene00040261

• WormBase Gene ID: WBGene00040261
• Gene Name: Cbr-coq-3
• Sequence Name: CBG21513
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 3,4-dihydroxy-5-polyprenylbenzoic acid O-methyltransferase activity and 3-demethylubiquinol-n 3-O-methyltransferase activity. Predicted to be involved in ubiquinone biosynthetic process. Is an ortholog of C. elegans coq-3. In C. elegans, coq-3 is involved in nematode larval development and ubiquinone biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21513a.1	CBG21513a.1		[unknown]
Transcript:CBG21513b.1	CBG21513b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21513b	CBG21513b		[unknown]
CDS:CBG21513a	CBG21513a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050308
• Remark: Cbr-coq-3, AATCACTGGACGTGGATCGAGTCGACACAGTGCAATTACGCTCTGTTGGCTGTGAAGAAA, WBGene00040261
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region