WormMine: Gene WBGene00040358

• WormBase Gene ID: WBGene00040358
• Gene Name: Cbr-daf-15
• Sequence Name: CBG21644
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in TOR signaling. Predicted to be part of TORC1 complex. Is an ortholog of C. elegans daf-15. In C. elegans, daf-15 is involved in dauer larval development; determination of adult lifespan; and regulation of autophagosome assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21644a.1	CBG21644a.1		[unknown]
Transcript:CBG21644b.1	CBG21644b.1		[unknown]
Transcript:CBG21644c.1	CBG21644c.1		[unknown]
Transcript:CBG21644d.1	CBG21644d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21644a	CBG21644a		[unknown]
CDS:CBG21644b	CBG21644b		[unknown]
CDS:CBG21644c	CBG21644c		[unknown]
CDS:CBG21644d	CBG21644d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064458
• Remark: Cbr-daf-15, GTCCACGATGACTCGAGAATCCTCGCATCAGCGTCAAGACAGCACGTGGCTATTTATGAT, WBGene00040358
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region