WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040392 Gene Name  Cbr-pezo-1
Sequence Name  ? CBG21689 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable mechanosensitive monoatomic ion channel activity. Predicted to be located in membrane. Is an ortholog of C. elegans pezo-1. In C. elegans, pezo-1 is involved in flagellated sperm motility; positive regulation of brood size; and positive regulation of ovulation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG21689a.1 CBG21689a.1   [unknown]
Transcript:CBG21689b.1 CBG21689b.1   [unknown]
Transcript:CBG21689c.1 CBG21689c.1   [unknown]
Transcript:CBG21689d.1 CBG21689d.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG21689b CBG21689b   [unknown]
CDS:CBG21689c CBG21689c   [unknown]
CDS:CBG21689a CBG21689a   [unknown]
CDS:CBG21689d CBG21689d   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG21690, CATCTTCTCAAGATTTGCCTCGATATTTATTTAGTGCGAGAAGCCAAGGATTTCATGTTG, WBGene00040393   Expr1061421 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG21689, TCCTTCACCATGGCTCCACTCATCCTGATCTACTGTGAATTCCTCCTTGTTCTTCAATAC, WBGene00040392   Expr1064274 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  located_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region