WormMine: Gene WBGene00040422

• WormBase Gene ID: WBGene00040422
• Gene Name: Cbr-rap-1
• Sequence Name: CBG21720
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in signal transduction. Predicted to be located in membrane. Is an ortholog of C. elegans rap-1. In C. elegans, rap-1 is involved in collagen and cuticulin-based cuticle development and epidermis development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21720.1	CBG21720.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21720	CBG21720		[unknown]

0 RNAi Result

9 Allele

• WBVar00130351
• WBVar00130350
• WBVar00130353
• WBVar00130352
• WBVar00130355
• WBVar00130354
• WBVar00130357
• WBVar00130356
• WBVar00130349

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069877
• Remark: Cbr-rap-1, GTAGGCAACAAGTGTGATTTGGAGGACGAGCGTGTCGTTGGCAAAGATCAGGGACAGAAT, WBGene00040422
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region