WormMine: Gene WBGene00040433

• WormBase Gene ID: WBGene00040433
• Gene Name: Cbr-pdzd-8
• Sequence Name: CBG21734
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in mitochondrial calcium ion homeostasis and mitochondrion-endoplasmic reticulum membrane tethering. Predicted to be located in mitochondria-associated endoplasmic reticulum membrane contact site. Is an ortholog of C. elegans pdzd-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21734a.1	CBG21734a.1		[unknown]
Transcript:CBG21734b.1	CBG21734b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21734b	CBG21734b		[unknown]
CDS:CBG21734a	CBG21734a		[unknown]

0 RNAi Result

2 Allele

• WBVar00031947
• WBVar00031952

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063112
• Remark: CBG21734, GAGTTGCCGCCTGAGGAGAGAGTCAAAAAGATCAATCTGCAAATCGATCGGATTCAGACG, WBGene00040433
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region