WormMine: Gene WBGene00040436

• WormBase Gene ID: WBGene00040436
• Gene Name: Cbr-bre-1
• Sequence Name: CBG21737
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GDP-mannose 4,6-dehydratase activity. Predicted to be involved in GDP-mannose metabolic process. Is an ortholog of C. elegans bre-1. In C. elegans, bre-1 is involved in GDP-L-fucose biosynthetic process; GDP-mannose metabolic process; and response to toxic substance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21737a.1	CBG21737a.1		[unknown]
Transcript:CBG21737c.1	CBG21737c.1		[unknown]
Transcript:CBG21737b.1	CBG21737b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21737c	CBG21737c		[unknown]
CDS:CBG21737b	CBG21737b		[unknown]
CDS:CBG21737a	CBG21737a		[unknown]

0 RNAi Result

1 Allele

• WBVar00031957

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062172
• Remark: CBG21737, CTCGTTAAAGAGATGGTCGCCAGTGATATTGCACTCATGAAGGCCAACCCAATGGCTTAA, WBGene00040436
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region