WormMine: Gene WBGene00040442

• WormBase Gene ID: WBGene00040442
• Gene Name: Cbr-acc-2
• Sequence Name: CBG21746
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable extracellular ligand-gated monoatomic ion channel activity and transmembrane signaling receptor activity. Predicted to be involved in monoatomic ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans acc-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21746.1	CBG21746.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21746	CBG21746		[unknown]

0 RNAi Result

33 Allele

• WBVar00130377
• WBVar00130376
• WBVar00130379
• WBVar00130378
• WBVar00130381
• WBVar00130380
• WBVar00130383
• WBVar00130382
• WBVar00130385
• WBVar00130384
• WBVar00130387
• WBVar00130386
• WBVar00130389
• WBVar00130388
• WBVar00130391
• WBVar00130390
• WBVar00130393
• WBVar00130392
• WBVar00130395
• WBVar00130394
• WBVar00130397
• WBVar00130396
• WBVar00130399
• WBVar00130398
• WBVar00130400
• WBVar00130403
• WBVar00130402
• WBVar00130405
• WBVar00130404
• WBVar00130407

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062415
• Remark: Cbr-acc-2, GAATCTTCAAAATCTCTGAATTCGTGTGGAACGGGATGTTGGACACCAGAACGCATCGAT, WBGene00040442
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region