WormMine: Gene WBGene00040485

• WormBase Gene ID: WBGene00040485
• Gene Name: Cbr-wnk-1
• Sequence Name: CBG21799
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Is an ortholog of C. elegans wnk-1. In C. elegans, wnk-1 is involved in several processes, including cell volume homeostasis; cellular hyperosmotic response; and multicellular organismal-level water homeostasis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21799a.1	CBG21799a.1		[unknown]
Transcript:CBG21799b.1	CBG21799b.1		[unknown]
Transcript:CBG21799c.1	CBG21799c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21799c	CBG21799c		[unknown]
CDS:CBG21799b	CBG21799b		[unknown]
CDS:CBG21799a	CBG21799a		[unknown]

0 RNAi Result

4 Allele

• WBVar00130471
• WBVar00130470
• WBVar00130473
• WBVar00130472

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060042
• Remark: Cbr-wnk-1, ATTTTATGCCCCGTAACCCTAACTAAAGGCGCCACCAGATTCCAGACAATGAAACAACCC, WBGene00040485
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region