WormMine: Gene WBGene00040489

• WormBase Gene ID: WBGene00040489
• Gene Name: Cbr-mrpl-39
• Sequence Name: CBG21806
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nucleotide binding activity. Is an ortholog of C. elegans mrpl-39.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21806.1	CBG21806.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21806	CBG21806		[unknown]

0 RNAi Result

11 Allele

• WBVar00056138
• WBVar00032347
• WBVar00032332
• WBVar00056143
• WBVar00032352
• WBVar00032337
• WBVar00032322
• WBVar00032357
• WBVar00056133
• WBVar00032342
• WBVar00032327

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1058845
• Remark: CBG21806, ACGTCGTCGTATTCATGGAGTCTCATCGCGAAGAATGCCATGCAGAAATTTAGTAGAACT, WBGene00040489
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region