WormMine: Gene WBGene00040542

• WormBase Gene ID: WBGene00040542
• Gene Name: Cbr-lag-2
• Sequence Name: CBG21862
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable Notch binding activity. Predicted to be involved in Notch signaling pathway and cell fate specification. Predicted to be located in membrane. Is an ortholog of C. elegans lag-2. In C. elegans, lag-2 is involved in several processes, including maintenance of dauer; regulation of basement membrane organization; and regulation of cell population proliferation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21862.1	CBG21862.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21862	CBG21862		[unknown]

0 RNAi Result

19 Allele

• WBVar00130561
• WBVar00130563
• WBVar00130562
• WBVar00130565
• WBVar00130564
• WBVar00130567
• WBVar00130566
• WBVar00130569
• WBVar00013349
• WBVar00130568
• WBVar00130571
• WBVar00130570
• WBVar00130573
• WBVar00130572
• WBVar00130575
• WBVar00130574
• WBVar00130577
• WBVar00130576
• WBVar00130578

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060409
• Remark: Cbr-lag-2, GTCAAGAAGGTTGATGAGGAGGAGATTCGATACACCAGCGCTCCAAGGAACAACGAGTAT, WBGene00040542
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region