WormMine: Gene WBGene00040545

• WormBase Gene ID: WBGene00040545
• Gene Name: Cbr-figl-1
• Sequence Name: CBG21866
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and ATP hydrolysis activity. Is an ortholog of C. elegans figl-1. In C. elegans, figl-1 is involved in ATP metabolic process and positive regulation of mitotic cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21866c.1	CBG21866c.1		[unknown]
Transcript:CBG21866b.1	CBG21866b.1		[unknown]
Transcript:CBG21866b.2	CBG21866b.2		[unknown]
Transcript:CBG21866a.1	CBG21866a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21866c	CBG21866c		[unknown]
CDS:CBG21866b	CBG21866b		[unknown]
CDS:CBG21866a	CBG21866a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057318
• Remark: Cbr-figl-1, AATATTATCTCGTTGATCGAGTCGGAAATCATGTCGGTGAATAATCAAATCGGATGGGCT, WBGene00040545
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region