WormMine: Gene WBGene00040612

• WormBase Gene ID: WBGene00040612
• Gene Name: Cbr-gpa-11
• Sequence Name: CBG21947
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G-protein beta/gamma-subunit complex binding activity; GTPase activity; and guanyl nucleotide binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Is an ortholog of C. elegans gpa-11. In C. elegans, gpa-11 is involved in determination of adult lifespan and serotonin receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21947.1	CBG21947.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21947	CBG21947		[unknown]

0 RNAi Result

10 Allele

• WBVar00032922
• WBVar00032907
• WBVar00032892
• WBVar00032927
• WBVar00032912
• WBVar00032897
• WBVar00032932
• WBVar00032917
• WBVar00032902
• WBVar00032937

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1054617
• Remark: Cbr-gpa-11, TATTCAACACGAGAAACCCGTCTATTCCCATTATACCAATGCCACGGACACCCGAAATAT, WBGene00040612
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region