Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG21947.1 | CBG21947.1 | [unknown] |
Other
10 Allele
Public Name |
---|
WBVar00032922 |
WBVar00032907 |
WBVar00032892 |
WBVar00032927 |
WBVar00032912 |
WBVar00032897 |
WBVar00032932 |
WBVar00032917 |
WBVar00032902 |
WBVar00032937 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-gpa-11, TATTCAACACGAGAAACCCGTCTATTCCCATTATACCAATGCCACGGACACCCGAAATAT, WBGene00040612 | Expr1054617 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |