WormMine: Gene WBGene00040694

• WormBase Gene ID: WBGene00040694
• Gene Name: Cbr-tol-1
• Sequence Name: CBG22058
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans tol-1. In C. elegans, tol-1 is involved in defense response to Gram-negative bacterium and embryo development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22058.1	CBG22058.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22058	CBG22058		[unknown]

0 RNAi Result

35 Allele

• WBVar00015934
• WBVar00015939
• WBVar00045254
• WBVar00033287
• WBVar00015879
• WBVar00015944
• WBVar00045259
• WBVar00015884
• WBVar00015949
• WBVar00045264
• WBVar00015889
• WBVar00015954
• WBVar00045269
• WBVar00015894
• WBVar00130971
• WBVar00015959
• WBVar00130970
• WBVar00130973
• WBVar00130972
• WBVar00045274
• WBVar00130975
• WBVar00130974
• WBVar00015899
• WBVar00015964
• WBVar00130976
• WBVar00015904
• WBVar00015969
• WBVar00015909
• WBVar00015974
• WBVar00015914

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069975
• Remark: Cbr-tol-1, TCAGATGGACTCATCGCAATGCTTGATCTTGGTTCTAACCAAACACTTTTTGGAAAACGA, WBGene00040694
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region