WormMine: Gene WBGene00040695

• WormBase Gene ID: WBGene00040695
• Gene Name: Cbr-dyf-11
• Sequence Name: CBG22059
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable microtubule binding activity. Is an ortholog of C. elegans dyf-11. In C. elegans, dyf-11 is involved in several processes, including cilium organization; dauer entry; and hyperosmotic response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22059.1	CBG22059.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22059	CBG22059		[unknown]

0 RNAi Result

1 Allele

• WBVar00041357

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061459
• Remark: Cbr-dyf-11, AGGGGATTACTGTAGAGAGGGAGAAAGTAAGACAACTACAGGAGAAACTGCAGGATTTGA, WBGene00040695
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region