WormMine: Gene WBGene00040725

• WormBase Gene ID: WBGene00040725
• Gene Name: Cbr-ints-1
• Sequence Name: CBG22096
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in U2 snRNA 3'-end processing. Predicted to be part of integrator complex. Is an ortholog of C. elegans ints-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22096.1	CBG22096.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22096	CBG22096		[unknown]

0 RNAi Result

25 Allele

• WBVar00131072
• WBVar00131073
• WBVar00131070
• WBVar00131071
• WBVar00131076
• WBVar00131077
• WBVar00131074
• WBVar00131075
• WBVar00131080
• WBVar00131081
• WBVar00131078
• WBVar00131079
• WBVar00131084
• WBVar00131085
• WBVar00131082
• WBVar00131083
• WBVar00033377
• WBVar00033382
• WBVar00131063
• WBVar00131065
• WBVar00131064
• WBVar00131067
• WBVar00131066
• WBVar00131069
• WBVar00131068

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058790
• Remark: CBG22096, GAAGGAGCAGACGGCGTTCGCCGAGTTGACCATCAAAGCGTGTGCTGAGTATTTGAATCA, WBGene00040725
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region