WormMine: Gene WBGene00040758

• WormBase Gene ID: WBGene00040758
• Gene Name: Cbr-spe-48
• Sequence Name: CBG22135
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ubiquitin binding activity. Predicted to be involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway. Predicted to be part of ESCRT I complex. Is an ortholog of C. elegans spe-48.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22135a.1	CBG22135a.1		[unknown]
Transcript:CBG22135b.1	CBG22135b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22135a	CBG22135a		[unknown]
CDS:CBG22135b	CBG22135b		[unknown]

0 RNAi Result

23 Allele

• WBVar00033402
• WBVar00131134
• WBVar00131135
• WBVar00131116
• WBVar00131117
• WBVar00131114
• WBVar00131115
• WBVar00131120
• WBVar00131121
• WBVar00131118
• WBVar00131119
• WBVar00131124
• WBVar00131125
• WBVar00131122
• WBVar00131123
• WBVar00131128
• WBVar00131129
• WBVar00131126
• WBVar00131127
• WBVar00131132
• WBVar00131133
• WBVar00131130
• WBVar00131131

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056986
• Remark: CBG22135, CTGGAATGAGTACGGTAGATCAAACGCTTCCATTCTTGATTCAATGCGAATTGAGTGATA, WBGene00040758
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region