WormMine: Gene WBGene00040795

• WormBase Gene ID: WBGene00040795
• Gene Name: CBG22173
• Sequence Name: CBG22173
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable zinc ion binding activity. Is an ortholog of C. elegans C26B9.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22173b.1	CBG22173b.1		[unknown]
Transcript:CBG22173a.1	CBG22173a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22173a	CBG22173a		[unknown]
CDS:CBG22173b	CBG22173b		[unknown]

0 RNAi Result

21 Allele

• WBVar00139835
• WBVar00139836
• WBVar00139833
• WBVar00139834
• WBVar00139839
• WBVar00139837
• WBVar00139838
• WBVar00139840
• WBVar00139820
• WBVar00139821
• WBVar00139824
• WBVar00139825
• WBVar00139822
• WBVar00139823
• WBVar00139828
• WBVar00139829
• WBVar00139826
• WBVar00139827
• WBVar00139831
• WBVar00139832
• WBVar00139830

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053452
• Remark: CBG22173, GATGACACAAACAAGTCAGAGCCATAGAGTGAGAGAGTCGGAGAGCTTTTTGACCAACTC, WBGene00040795
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region