WormMine: Gene WBGene00040820

• WormBase Gene ID: WBGene00040820
• Gene Name: Cbr-egl-30
• Sequence Name: CBG22211
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable several functions, including G-protein beta/gamma-subunit complex binding activity; GTPase activity; and guanyl nucleotide binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Is an ortholog of C. elegans egl-30. In C. elegans, egl-30 is involved in several processes, including cellular response to dopamine; positive regulation of protein localization; and regulation of secretion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22211.1	CBG22211.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22211	CBG22211		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054995
• Remark: Cbr-egl-30, AATATTCGGTTCGTGTTTGCCGCCGTCAAAGACACAATTCTGCAGCATAATCTGAAGGAG, WBGene00040820
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region