WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040906 Gene Name  Cbr-unc-31
Sequence Name  ? CBG22310 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in dense core granule exocytosis and synaptic vesicle exocytosis. Is an ortholog of C. elegans unc-31. In C. elegans, unc-31 is involved in several processes, including cellular response to carbon dioxide; regulation of multicellular organismal process; and signal release. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

10 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG22310g.1 CBG22310g.1   [unknown]
Transcript:CBG22310h.1 CBG22310h.1   [unknown]
Transcript:CBG22310i.1 CBG22310i.1   [unknown]
Transcript:CBG22310j.1 CBG22310j.1   [unknown]
Transcript:CBG22310c.1 CBG22310c.1   [unknown]
Transcript:CBG22310d.1 CBG22310d.1   [unknown]
Transcript:CBG22310e.1 CBG22310e.1   [unknown]
Transcript:CBG22310f.1 CBG22310f.1   [unknown]
Transcript:CBG22310a.1 CBG22310a.1   [unknown]
Transcript:CBG22310b.1 CBG22310b.1   [unknown]
 

Other

10 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG22310j CBG22310j   [unknown]
CDS:CBG22310a CBG22310a   [unknown]
CDS:CBG22310i CBG22310i   [unknown]
CDS:CBG22310h CBG22310h   [unknown]
CDS:CBG22310g CBG22310g   [unknown]
CDS:CBG22310f CBG22310f   [unknown]
CDS:CBG22310e CBG22310e   [unknown]
CDS:CBG22310d CBG22310d   [unknown]
CDS:CBG22310c CBG22310c   [unknown]
CDS:CBG22310b CBG22310b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-unc-31, GCTGACTGAACGTCTTCAACAGTCTTTAAGTGCAACCCAGTTCATTTCTCTTTCCAATAT, WBGene00040906   Expr1061341 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region