WormMine: Gene WBGene00041010

• WormBase Gene ID: WBGene00041010
• Gene Name: Cbr-egl-23
• Sequence Name: CBG22456
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans egl-23.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22456a.1	CBG22456a.1		[unknown]
Transcript:CBG22456c.1	CBG22456c.1		[unknown]
Transcript:CBG22456b.1	CBG22456b.1		[unknown]
Transcript:CBG22456d.1	CBG22456d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22456d	CBG22456d		[unknown]
CDS:CBG22456c	CBG22456c		[unknown]
CDS:CBG22456b	CBG22456b		[unknown]
CDS:CBG22456a	CBG22456a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055079
• Remark: Cbr-egl-23, CGACCACTAACTGCCGCTGAAATAGCCGCCCAAAAGCGCAAAGCTTACAGTGAAGAAGCG, WBGene00041010
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region