WormMine: Gene WBGene00041016

• WormBase Gene ID: WBGene00041016
• Gene Name: CBG22463
• Sequence Name: CBG22463
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Is an ortholog of C. elegans dnbp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22463.1	CBG22463.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22463	CBG22463		[unknown]

0 RNAi Result

36 Allele

• WBVar00139901
• WBVar00139902
• WBVar00139900
• WBVar00139905
• WBVar00139906
• WBVar00139903
• WBVar00139904
• WBVar00139909
• WBVar00139907
• WBVar00139908
• WBVar00139912
• WBVar00139913
• WBVar00139910
• WBVar00139911
• WBVar00139914
• WBVar00131745
• WBVar00131748
• WBVar00131749
• WBVar00131746
• WBVar00131747
• WBVar00131752
• WBVar00131753
• WBVar00131750
• WBVar00131751
• WBVar00131756
• WBVar00131757
• WBVar00131754
• WBVar00131755
• WBVar00131760
• WBVar00131761

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058428
• Remark: CBG22463, GTCCTTCAACGAACCGACGACGACGGCAATCCCGAATGGCTTCTGATTAAACGAGCCAGC, WBGene00041016
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region