WormMine: Gene WBGene00041085

• WormBase Gene ID: WBGene00041085
• Gene Name: Cbr-pat-6
• Sequence Name: CBG22549
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin binding activity. Predicted to be involved in actin cytoskeleton organization and cell adhesion. Is an ortholog of C. elegans pat-6. In C. elegans, pat-6 is involved in several processes, including muscle cell cellular homeostasis; positive regulation of sarcomere organization; and striated muscle cell development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22549.1	CBG22549.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22549	CBG22549		[unknown]

0 RNAi Result

37 Allele

• WBVar00131968
• WBVar00131969
• WBVar00131966
• WBVar00131967
• WBVar00012349
• WBVar00131972
• WBVar00131973
• WBVar00131970
• WBVar00131971
• WBVar00012354
• WBVar00131976
• WBVar00131977
• WBVar00131974
• WBVar00131975
• WBVar00012359
• WBVar00131978
• WBVar00131979
• WBVar00012364
• WBVar00012369
• WBVar00012374
• WBVar00012379
• WBVar00012329
• WBVar00012334
• WBVar00131956
• WBVar00131957
• WBVar00131954
• WBVar00131955
• WBVar00131960
• WBVar00012339
• WBVar00131961

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051503
• Remark: Cbr-pat-6, CCCGCTGTACCATTTCAATTTGCAAGTTCATGGACACGAGGAGAAGGTCAAGAATGTGCA, WBGene00041085
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region