WormMine: Gene WBGene00041184

• WormBase Gene ID: WBGene00041184
• Gene Name: Cbr-haf-4
• Sequence Name: CBG22668
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and transmembrane transporter activity. Predicted to be involved in peptide transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans haf-4. In C. elegans, haf-4 is involved in lipid metabolic process and lysosomal transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22668.1	CBG22668.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22668	CBG22668		[unknown]

0 RNAi Result

19 Allele

• WBVar00132305
• WBVar00132308
• WBVar00132309
• WBVar00132306
• WBVar00132307
• WBVar00132312
• WBVar00132313
• WBVar00132310
• WBVar00132311
• WBVar00132316
• WBVar00132317
• WBVar00132314
• WBVar00132315
• WBVar00132318
• WBVar00132319
• WBVar00034782
• WBVar00038309
• WBVar00038314
• WBVar00038319

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058673
• Remark: Cbr-haf-4, GAAGCCACGTCGGCGTTGGATACGGAATCCGAGCATGTTGTACAAGAAGCGATTTATAAG, WBGene00041184
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region