WormMine: Gene WBGene00041259

• WormBase Gene ID: WBGene00041259
• Gene Name: CBG22774
• Sequence Name: CBG22774
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable carboxylic ester hydrolase activity. Predicted to be located in membrane. Is an ortholog of C. elegans F16F9.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22774.1	CBG22774.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22774	CBG22774		[unknown]

0 RNAi Result

19 Allele

• WBVar00035834
• WBVar00007804
• WBVar00007774
• WBVar00035839
• WBVar00007809
• WBVar00007779
• WBVar00035844
• WBVar00007784
• WBVar00035849
• WBVar00007789
• WBVar00007759
• WBVar00132408
• WBVar00007794
• WBVar00132409
• WBVar00007764
• WBVar00132407
• WBVar00007799
• WBVar00132410
• WBVar00007769

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060819
• Remark: CBG22774, AAACTTAAACAATCAGGCGTTCGCACAATTTGGCAGCATTTCCCCCGTGCATTCCATGGT, WBGene00041259
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region