WormMine: Gene WBGene00041332

• WormBase Gene ID: WBGene00041332
• Gene Name: Cbr-nhr-102
• Sequence Name: CBG22870
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-102.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22870.1	CBG22870.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22870	CBG22870		[unknown]

0 RNAi Result

32 Allele

• WBVar00037564
• WBVar00037569
• WBVar00037574
• WBVar00037579
• WBVar00037584
• WBVar00037589
• WBVar00132512
• WBVar00132513
• WBVar00132511
• WBVar00132516
• WBVar00132517
• WBVar00132514
• WBVar00132515
• WBVar00132520
• WBVar00132521
• WBVar00132518
• WBVar00132519
• WBVar00132524
• WBVar00132525
• WBVar00132522
• WBVar00132523
• WBVar00132528
• WBVar00132529
• WBVar00132526
• WBVar00037549
• WBVar00132527
• WBVar00132532
• WBVar00132533
• WBVar00132530
• WBVar00132531

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053481
• Remark: Cbr-nhr-102, TATTTAAAAGAGGAAATGAGATCGAATTACGCTGGTCGTTTGGTTCGGCTGATGAGTGTT, WBGene00041332
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region