WormMine: Gene WBGene00041391

• WormBase Gene ID: WBGene00041391
• Gene Name: Cbr-clp-1
• Sequence Name: CBG22945
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium-dependent cysteine-type endopeptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans clp-1. In C. elegans, clp-1 is involved in several processes, including cellular response to calcium ion; muscle cell cellular homeostasis; and positive regulation of sarcomere organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22945c.1	CBG22945c.1		[unknown]
Transcript:CBG22945b.1	CBG22945b.1		[unknown]
Transcript:CBG22945a.1	CBG22945a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22945a	CBG22945a		[unknown]
CDS:CBG22945b	CBG22945b		[unknown]
CDS:CBG22945c	CBG22945c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1052821
• Remark: Cbr-clp-1, TGATCCCGACGATGACGATGAGCTGTGCACGGTGATTTTTGCCGTTATGCAAAAATACAG, WBGene00041391
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region