WormMine: Gene WBGene00041489

• WormBase Gene ID: WBGene00041489
• Gene Name: Cbr-vps-36
• Sequence Name: CBG23064
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphatidylinositol-3-phosphate binding activity and ubiquitin binding activity. Predicted to be involved in endosome transport via multivesicular body sorting pathway. Predicted to be part of ESCRT II complex. Is an ortholog of C. elegans vps-36.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23064.1	CBG23064.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23064	CBG23064		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058432
• Remark: Cbr-vps-36, TGAAATCAGCATCTATGGAGAGTACTGTAGCCCAAACGCTAGAGTTTGTTTCGAAACTGG, WBGene00041489
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region