WormMine: Gene WBGene00041499

• WormBase Gene ID: WBGene00041499
• Gene Name: Cbr-pptr-2
• Sequence Name: CBG23076
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein phosphatase regulator activity. Predicted to be involved in signal transduction. Predicted to be part of protein phosphatase type 2A complex. Is an ortholog of C. elegans pptr-2. In C. elegans, pptr-2 is involved in P granule assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23076a.1	CBG23076a.1		[unknown]
Transcript:CBG23076b.1	CBG23076b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23076b	CBG23076b		[unknown]
CDS:CBG23076a	CBG23076a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070176
• Remark: Cbr-pptr-2, CGAGCAAACGACGAGAGCTCTCGGCGAGTACAAGCGTCACGATCAGTTCCTGAAAAAAGT, WBGene00041499
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region