WormMine: Gene WBGene00041543

• WormBase Gene ID: WBGene00041543
• Gene Name: CBG23133
• Sequence Name: CBG23133
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans clc-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23133a.1	CBG23133a.1		[unknown]
Transcript:CBG23133b.1	CBG23133b.1		[unknown]
Transcript:CBG23133b.2	CBG23133b.2		[unknown]
Transcript:CBG23133c.1	CBG23133c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23133a	CBG23133a		[unknown]
CDS:CBG23133b	CBG23133b		[unknown]
CDS:CBG23133c	CBG23133c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055697
• Remark: CBG23133, GGAGCATTCATTTGCACACTTCTCACCGTTTACAAATTTGTTGCGGGAGGTCAAGATGAC, WBGene00041543
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region