WormMine: Gene WBGene00041564

• WormBase Gene ID: WBGene00041564
• Gene Name: Cbr-gly-20
• Sequence Name: CBG23158
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity. Predicted to be involved in oligosaccharide biosynthetic process. Predicted to be located in Golgi stack and membrane. Is an ortholog of C. elegans gly-20. In C. elegans, gly-20 is involved in protein N-linked glycosylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23158.1	CBG23158.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23158	CBG23158		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060905
• Remark: Cbr-gly-20, GCGAAATGTCTTCCACAAAGGTTTCGAGTCATTTTCACGAAGAGTCCACGAGTGATACAC, WBGene00041564
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region