WormMine: Gene WBGene00041636

• WormBase Gene ID: WBGene00041636
• Gene Name: Cbr-nphp-4
• Sequence Name: CBG23249
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in negative regulation of canonical Wnt signaling pathway. Predicted to be located in cytoskeleton and non-motile cilium. Is an ortholog of C. elegans nphp-4. In C. elegans, nphp-4 is involved in several processes, including determination of adult lifespan; male mating behavior; and plasma membrane bounded cell projection organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23249.1	CBG23249.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23249	CBG23249		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052058
• Remark: Cbr-nph-4, ATGTTCGAAGTATTGTTGGTCAAACCACCCGACTACATCTTTTGGTACATAGAAGAAGGT, WBGene00041636
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region