WormMine: Gene WBGene00041648

• WormBase Gene ID: WBGene00041648
• Gene Name: Cbr-pyc-1
• Sequence Name: CBG23262
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and pyruvate carboxylase activity. Predicted to be involved in gluconeogenesis and pyruvate metabolic process. Is an ortholog of C. elegans pyc-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23262.1	CBG23262.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23262	CBG23262		[unknown]

0 RNAi Result

13 Allele

• WBVar00027104
• WBVar00132936
• WBVar00132937
• WBVar00027109
• WBVar00132940
• WBVar00132941
• WBVar00132938
• WBVar00132939
• WBVar00132944
• WBVar00132945
• WBVar00132942
• WBVar00132943
• WBVar00132946

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060658
• Remark: Cbr-pyc-1, ATGAAAATGGAGATGGTAATCGACTCGCCAATTGCTGGAACAGTCAAGGCTATCCATGCT, WBGene00041648
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region