WormMine: Gene WBGene00041694

• WormBase Gene ID: WBGene00041694
• Gene Name: Cbr-pms-2
• Sequence Name: CBG23320
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable several functions, including ATP binding activity; ATP hydrolysis activity; and ATP-dependent DNA damage sensor activity. Predicted to be involved in mismatch repair. Predicted to be part of mismatch repair complex. Is an ortholog of C. elegans pms-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23320.1	CBG23320.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23320	CBG23320		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064132
• Remark: Cbr-pms-2, CCATGGAAGACCGACTATCCGTCATCTAGTGTCACTGCCAAATAAACCAGAAACTGATTA, WBGene00041694
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region