WormMine: Gene WBGene00034237

• WormBase Gene ID: WBGene00034237
• Gene Name: Cbr-sra-35
• Sequence Name: CBG13478
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Is an ortholog of C. elegans sra-35.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13478.1	CBG13478.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13478	CBG13478		[unknown]

0 RNAi Result

18 Allele

• WBVar00119908
• WBVar00119909
• WBVar00119910
• WBVar00119911
• WBVar00119925
• WBVar00119923
• WBVar00119924
• WBVar00119918
• WBVar00119919
• WBVar00119916
• WBVar00119917
• WBVar00119914
• WBVar00119915
• WBVar00119912
• WBVar00119913
• WBVar00119921
• WBVar00119922
• WBVar00119920

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067068
• Remark: Cbr-sra-35, AAGGAGACAATGGATGCAAGAATGGCGCAATTGAGAAATTCATGGGACGCTCAGGCTCCG, WBGene00034237
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region