WormMine: Gene WBGene00041724

• WormBase Gene ID: WBGene00041724
• Gene Name: Cbr-pkc-1
• Sequence Name: CBG23354
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and diacylglycerol-dependent serine/threonine kinase activity. Is an ortholog of C. elegans pkc-1. In C. elegans, pkc-1 is involved in several processes, including nervous system process; regulation of presynaptic dense core granule exocytosis; and signaling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23354a.1	CBG23354a.1		[unknown]
Transcript:CBG23354b.1	CBG23354b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23354b	CBG23354b		[unknown]
CDS:CBG23354a	CBG23354a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056468
• Remark: Cbr-pkc-1, GAATGCTAGCAAACGATTAGGATGTGTTGTCTCGCAAGGAGGTGAAGATGCTATTCGTGC, WBGene00041724
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region