WormMine: Gene WBGene00041781

• WormBase Gene ID: WBGene00041781
• Gene Name: Cbr-rad-50
• Sequence Name: CBG23420
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP hydrolysis activity. Predicted to be involved in double-strand break repair and telomere maintenance. Predicted to be located in nucleus. Predicted to be part of Mre11 complex. Is an ortholog of C. elegans rad-50.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23420.1	CBG23420.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23420	CBG23420		[unknown]

0 RNAi Result

7 Allele

• WBVar00133024
• WBVar00133025
• WBVar00133028
• WBVar00027199
• WBVar00133026
• WBVar00133027
• WBVar00027204

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1061933
• Remark: Cbr-rad-50, AACAAAATCACTCTCAGCTGCCGTCCAGATTATATCTACTGTTTGGGGAAGGATGAGCAT, WBGene00041781
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region